Tests Overview

Use the links in the list below to view results for an individual data set, or navigate this page to compare mapper performance across all data sets.

8 tests executed, 2 fail, 0 aborted, 0 errors total.
StateNameReferenceExecutedOKWarningsErrors
E_coliE_coli8606
Errors and Warnings
No problems were encountered.
Results: Correctly Mapped Reads
Results: Correct/s
Results: Precision
Results: Recall
Results: F-Measure
Raw Results
Setup

This section contains information about the benchmarking process itself and can be shared in order to reproduce results and diagnose problems.

Teaser Accession3f0952a92d640dea6a7f5d449db65923
Report timestampThu Aug 30 14:48:17 2018
Framework Version1.2-public-vevev
Framework Working Directory/project/teaser/genometeaser
Framework Command Line./teaser.py setups_generated/3f0952a92d640dea6a7f5d449db65923.yaml -mcpu
Benchmark Configuration
evaluation: {pos_threshold: 50}
include: [base_teaser.yaml]
meta_timestamp: 1535628912.089658
report: {name: 3f0952a92d640dea6a7f5d449db65923}
sub_max_memory: 14000
sub_max_runtime: 900
teaser:
  tests:
    3f0952a92d640dea6a7f5d449db65923: {coverage: 1.0, error_rate_mult: 11.0, mutation_indel_avg_len: 1.0,
      mutation_indel_frac: 0.3, mutation_rate: 0.01, paired: false, platform: !!python/unicode 'ion_torrent',
      read_length: 100, reference: !!python/unicode 'E_coli.fasta', title: !!python/unicode 'E_coli',
      type: !!python/unicode 'simulated_teaser'}
test_mappers: [bowtie2, bwa, bwamem, bwasw, ngm, ngm_0_4_11, segemehl, stampy]
test_parameters: []
threads: 4
Log
[13:35:16] [Main        ] framework cmd:  ./teaser.py setups_generated/3f0952a92d640dea6a7f5d449db65923.yaml -mcpu
[13:35:16] [Main        ] framework hash: vevev
[13:35:16] [Main        ] deployment mode: devel (True)
[13:35:16] [Main        ] Test Runner Setup - ""

[13:35:16] [Main        ] Using Teaser for data set creation
[13:35:16] [Teaser      ] Init. Creating 1 test datasets.
[13:35:16] [Teaser      ] 
[13:35:16] [Teaser      ] Creating test 3f0952a92d640dea6a7f5d449db65923
[13:35:16] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923
[13:35:16] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923
[13:35:16] [Teaser      ] Loaded index from /project/teaser/genometeaser/references/E_coli.fasta.teaser.findex
[13:35:16] [Teaser      ] csample /project/teaser/genometeaser/references/E_coli.fasta 1000 0.500000
[13:35:16] [Teaser      ] Loaded index from /project/teaser/genometeaser/references/E_coli.fasta.teaser.findex
[13:35:16] [Teaser      ] Sampling as contig: 2566 regions of size 1000 (pad 200), totalling 2566034 base pairs
[13:35:16] [Teaser      ] Sampling 2566 regions
[13:35:17] [Teaser      ] 10%
[13:35:18] [Teaser      ] 20%
[13:35:18] [Teaser      ] 30%
[13:35:19] [Teaser      ] 40%
[13:35:19] [Teaser      ] 50%
[13:35:20] [Teaser      ] 60%
[13:35:20] [Teaser      ] 70%
[13:35:21] [Teaser      ] 80%
[13:35:21] [Teaser      ] 90%
[13:35:22] [Teaser      ] 100%
[13:35:22] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923
[13:35:22] [Teaser      ] subprogram /project/teaser/genometeaser/software/dwgsim -c 2 -1 100 -2 0 -N 150000 -f TACGTACGTCTGAGCATCGATCGATGTACAGC  -d 500 -s 50  -r 0.010000  -R 0.300000  -y 0  -e 0.220000  /project/teaser/genometeaser/references/E_coli.fasta.sampled.2.1000.200.fasta dwgout
[13:36:36] [Teaser      ] move enc_dwgout.bwa.read1.fastq -> reads.fastq
[13:36:36] [Teaser      ] move enc_dwgout.bwa.read1.fastq.sam -> mapping_comparison.sam
[13:36:36] [Teaser      ] remove dwgout.bwa.read1.fastq.sam
[13:36:36] [Teaser      ] remove dwgout.mutations.txt
[13:36:36] [Teaser      ] remove dwgout.mutations.vcf
[13:36:36] [Teaser      ] remove dwgout.bfast.fastq
[13:36:36] [Teaser      ] remove dwgout.bwa.read1.fastq
[13:36:36] [Teaser      ] remove dwgout.bwa.read2.fastq
[13:36:36] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923
[13:36:36] [Teaser      ] move mapping_comparison.sam -> mapping_comparison_unfixed.sam
[13:36:36] [Teaser      ] Translating SAM file coordinates (as contig)...
[13:36:36] [Teaser      ] Loaded index from /project/teaser/genometeaser/references/E_coli.fasta.teaser.findex
[13:36:38] [Teaser      ] Warning: Len of source sample set = 0, read Y29udGlnXzE3ODA3NzVfMV8wXzBfMF8wXzUyOjE6MF8wOjA6MF8xYmQ3
[13:36:43] [Teaser      ] Warning: Len of source sample set = 0, read Y29udGlnXzE3ODA2MThfMV8wXzBfMF8wXzA6MDowXzA6MDowXzgwMmE=
[13:36:46] [Teaser      ] Warning: Len of source sample set = 0, read Y29udGlnXzE3ODA2ODBfMV8xXzFfMF8wXzA6MDowXzA6MDowX2Q2MjQ=
[13:36:53] [Teaser      ] Warning: Len of source sample set = 0, read Y29udGlnXzE3ODA3MjNfMV8wXzBfMF8wXzY6MDowXzA6MDowXzE3ZWJl
[13:36:54] [Teaser      ] Warning: Len of source sample set = 0, read Y29udGlnXzE3ODA2OTNfMV8wXzBfMF8wXzA6MDowXzA6MDowXzE5OTc4
[13:36:57] [Teaser      ] Warning: Len of source sample set = 0, read Y29udGlnXzE3ODA3NzBfMV8wXzBfMF8wXzYyOjE6MF8wOjA6MF8xZTQwZg==
[13:36:57] [Teaser      ] Warning: Len of source sample set = 0, read Y29udGlnXzE3ODA2NzBfMV8xXzFfMF8wXzA6MDowXzA6MDowXzFlYzUx
[13:37:10] [Teaser      ] remove /project/teaser/genometeaser/references/E_coli.fasta.sampled.2.1000.200.fasta
[13:37:10] [Teaser      ] remove /project/teaser/genometeaser/references/E_coli.fasta.sampled.2.1000.200.fasta.index
[13:37:10] [Teaser      ] remove mapping_comparison_unfixed.sam
[13:37:10] [Teaser      ] Took 113 seconds for generating 3f0952a92d640dea6a7f5d449db65923
[13:37:10] [Main        ] Data set creation completed
[13:37:10] [Main        ] 
[13:37:12] [bowtie2     ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[13:37:12] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[13:37:12] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[13:37:12] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_bowtie2.sam
[13:37:12] [map         ] Command(pre): 
[13:37:12] [map         ] Base run time file not existing, performing base run
[13:37:12] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bowtie2/bowtie2  -p 4 -x /project/teaser/genometeaser/references/E_coli.fasta_bt -U reads_base.fastq -S out_bowtie2.sam
[13:37:18] [map         ] Command(main): /project/teaser/genometeaser/software/bowtie2/bowtie2  -p 4 -x /project/teaser/genometeaser/references/E_coli.fasta_bt -U reads.fastq -S out_bowtie2.sam
[13:37:18] [map         ]    Mapping 61.00MB to 5.00MB with bowtie2...
[13:37:37] [map         ]    Took 18.294 (wall), 20.276 (CPU) seconds, initialization time: 0.784 (wall), 0.488 (CPU) seconds.
[13:37:37] [map         ] Command(post): 
[13:37:37] [sort_prepare] Sorting...
[13:38:01] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[13:38:10] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
0,0,149993,0,7,149993,0,0,0,0,0

[13:38:10] [bwa         ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[13:38:10] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[13:38:10] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[13:38:10] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_bwa.sam
[13:38:10] [map         ] Command(pre): 
[13:38:10] [map         ] Base run time file not existing, performing base run
[13:38:10] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bwa aln /project/teaser/genometeaser/references/E_coli.fasta reads_base.fastq  -t 4 > out_bwa.sam.bwa; /project/teaser/genometeaser/software/bwa samse /project/teaser/genometeaser/references/E_coli.fasta out_bwa.sam.bwa reads_base.fastq > out_bwa.sam
[13:38:14] [map         ] Command(main): /project/teaser/genometeaser/software/bwa aln /project/teaser/genometeaser/references/E_coli.fasta reads.fastq  -t 4 > out_bwa.sam.bwa; /project/teaser/genometeaser/software/bwa samse /project/teaser/genometeaser/references/E_coli.fasta out_bwa.sam.bwa reads.fastq > out_bwa.sam
[13:38:14] [map         ]    Mapping 61.00MB to 5.00MB with bwa...
[13:38:30] [map         ]    Took 15.641 (wall), 11.396 (CPU) seconds, initialization time: 0.214 (wall), 0.064 (CPU) seconds.
[13:38:30] [map         ] Command(post): 
[13:38:30] [sort_prepare] Sorting...
[13:38:47] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[13:38:55] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
0,0,149993,0,7,149993,0,0,0,0,0

[13:38:55] [bwamem      ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[13:38:55] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[13:38:55] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[13:38:55] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_bwamem.sam
[13:38:55] [map         ] Command(pre): 
[13:38:55] [map         ] Base run time file not existing, performing base run
[13:38:55] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bwa mem /project/teaser/genometeaser/references/E_coli.fasta reads_base.fastq  -t 4 > out_bwamem.sam
[13:38:57] [map         ] Command(main): /project/teaser/genometeaser/software/bwa mem /project/teaser/genometeaser/references/E_coli.fasta reads.fastq  -t 4 > out_bwamem.sam
[13:38:57] [map         ]    Mapping 61.00MB to 5.00MB with bwamem...
[13:39:18] [map         ]    Took 20.605 (wall), 38.772 (CPU) seconds, initialization time: 0.123 (wall), 0.032 (CPU) seconds.
[13:39:18] [map         ] Command(post): 
[13:39:18] [sort_prepare] Sorting...
[13:39:36] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[13:39:43] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
3,2,149988,0,7,149993,0,0,0.6,2.0001200072e-05,4.00010666951e-05

[13:39:43] [bwasw       ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[13:39:43] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[13:39:43] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[13:39:43] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_bwasw.sam
[13:39:43] [map         ] Command(pre): 
[13:39:43] [map         ] Base run time file not existing, performing base run
[13:39:43] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bwa bwasw /project/teaser/genometeaser/references/E_coli.fasta reads_base.fastq  -t 4 > out_bwasw.sam
[13:39:45] [map         ] Command(main): /project/teaser/genometeaser/software/bwa bwasw /project/teaser/genometeaser/references/E_coli.fasta reads.fastq  -t 4 > out_bwasw.sam
[13:39:45] [map         ]    Mapping 61.00MB to 5.00MB with bwasw...
[13:40:19] [map         ]    Took 33.553 (wall), 77.716 (CPU) seconds, initialization time: 0.078 (wall), 0.056 (CPU) seconds.
[13:40:19] [map         ] Command(post): 
[13:40:20] [sort_prepare] Sorting...
[13:40:36] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[13:40:47] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
1,0,149992,0,7,149993,0,0,1.0,6.6669777923e-06,1.3333866688e-05

[13:40:47] [ngm         ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[13:40:47] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[13:40:47] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[13:40:47] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_ngm.sam
[13:40:47] [map         ] Command(pre): 
[13:40:47] [map         ] Base run time file not existing, performing base run
[13:40:47] [map         ] Command(pre-b): /project/teaser/genometeaser/software/ngm/ngm --output out_ngm.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress
[13:41:40] [map         ] Command(main): /project/teaser/genometeaser/software/ngm/ngm --output out_ngm.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads.fastq  --no-progress
[13:41:40] [map         ]    Mapping 61.00MB to 5.00MB with ngm...
[13:42:41] [map         ]    Took 60.311 (wall), 113.644 (CPU) seconds, initialization time: 7.122 (wall), 6.876 (CPU) seconds.
[13:42:41] [map         ] Command(post): 
[13:42:41] [sort_prepare] Sorting...
[13:42:56] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[13:43:09] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
631,48,149314,0,7,149993,0,0,0.929307805596,0.00420820967688,0.00837847886127

[13:43:09] [ngm_0_4_11  ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[13:43:09] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[13:43:09] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[13:43:09] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_ngm_0_4_11.sam
[13:43:09] [map         ] Command(pre): 
[13:43:09] [map         ] Base run time file not existing, performing base run
[13:43:09] [map         ] Command(pre-b): /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress
[13:58:10] [map         ] Subprocess exceeded maximum allowed runtime: /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress at None:None
[13:58:10] [map         ] None

[14:13:11] [map         ] Subprocess exceeded maximum allowed runtime: /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress at None:None
[14:13:11] [map         ] None

[14:13:11] [map         ] Command(main): /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads.fastq  --no-progress
[14:13:11] [map         ]    Mapping 61.00MB to 5.00MB with ngm_0_4_11...
[14:28:12] [map         ] Subprocess exceeded maximum allowed runtime: /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads.fastq  --no-progress at None:None
[14:28:12] [map         ] None

[14:28:12] [map         ]    Took 0.000 (wall), 0.000 (CPU) seconds, initialization time: 0.000 (wall), 0.000 (CPU) seconds.
[14:28:12] [map         ] Command(post): 
[14:28:12] [sort_prepare] Sorting...
[14:28:27] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:28:39] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
255,17,147696,2025,1021,149993,0,0,0.9375,0.00172354360565,0.00344076155522
[14:28:39] [calc_time   ] Runtime < Init runtime, using unadjusted runtime as mapping time at None:None
[14:28:39] [calc_time   ] None

[14:28:39] [calc_time   ] 	*** [INTERNAL] Error occured executing pipeline main on test 3f0952a92d640dea6a7f5d449db65923: 'memory', traceback: Traceback (most recent call last):
  File "/project/teaser/genometeaser/lib/test.py", line 432, in executePipeline
    result = script_locals[script_name](self, *args)
  File "tests_base/base_mapping/calc_time.py", line 42, in calc_time
    stats_out.memory = mapper_result["memory"]
KeyError: 'memory'

[14:28:39] [calc_time   ] Error occured executing pipeline main: 'memory', traceback: Traceback (most recent call last):
  File "/project/teaser/genometeaser/lib/test.py", line 432, in executePipeline
    result = script_locals[script_name](self, *args)
  File "tests_base/base_mapping/calc_time.py", line 42, in calc_time
    stats_out.memory = mapper_result["memory"]
KeyError: 'memory'
 at Test 3f0952a92d640dea6a7f5d449db65923:main
[14:28:39] [calc_time   ] Traceback (most recent call last):
  File "/project/teaser/genometeaser/lib/test.py", line 432, in executePipeline
    result = script_locals[script_name](self, *args)
  File "tests_base/base_mapping/calc_time.py", line 42, in calc_time
    stats_out.memory = mapper_result["memory"]
KeyError: 'memory'

[14:28:39]  -> Errors in test, not caching!

[14:28:39] [segemehl    ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[14:28:39] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:28:39] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[14:28:39] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_segemehl.sam
[14:28:39] [map         ] Command(pre): 
[14:28:39] [map         ] Base run time file not existing, performing base run
[14:28:39] [map         ] Command(pre-b): /project/teaser/genometeaser/software/segemehl.x  -r 1 -i /project/teaser/genometeaser/references/E_coli.fasta.idx -d /project/teaser/genometeaser/references/E_coli.fasta -q reads_base.fastq > out_segemehl.sam
[14:28:50] [map         ] Command(main): /project/teaser/genometeaser/software/segemehl.x  -r 1 -i /project/teaser/genometeaser/references/E_coli.fasta.idx -d /project/teaser/genometeaser/references/E_coli.fasta -q reads.fastq > out_segemehl.sam
[14:28:50] [map         ]    Mapping 61.00MB to 5.00MB with segemehl...
[14:42:40] [map         ]    Took 828.516 (wall), 798.100 (CPU) seconds, initialization time: 0.816 (wall), 0.528 (CPU) seconds.
[14:42:40] [map         ] Command(post): 
[14:42:40] [sort_prepare] Sorting...
[14:42:40] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:42:44] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
0,0,0,149993,0,149993,0,0,0,0,0
[14:42:44] [calc_stats  ] Unexpectedly reached end of mapper output at sorted_out_segemehl.sam:Y29udGlnXzc0MDA0N18xXzBfMF8wXzBfMTA3OjA6MV8wOjA6MF9hZmVm
[14:42:44] [calc_stats  ] None

[14:42:44] [segemehl    ] Errors in test, not caching!

[14:42:44] [stampy      ] 3f0952a92d640dea6a7f5d449db65923 (base: tests_base/base_mapping)
[14:42:44] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:42:44] [init        ] Reads: /project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/reads.fastq
[14:42:44] [init        ] Output:/project/teaser/genometeaser/tests_generated/3f0952a92d640dea6a7f5d449db65923/out_stampy.sam
[14:42:44] [map         ] Command(pre): 
[14:42:44] [map         ] Base run time file not existing, performing base run
[14:42:44] [map         ] Command(pre-b): /project/teaser/genometeaser/software/stampy  -t 4 -g /project/teaser/genometeaser/references/E_coli.fasta_o -h /project/teaser/genometeaser/references/E_coli.fasta_o -M reads_base.fastq -o out_stampy.sam
[14:42:49] [map         ] Command(main): /project/teaser/genometeaser/software/stampy  -t 4 -g /project/teaser/genometeaser/references/E_coli.fasta_o -h /project/teaser/genometeaser/references/E_coli.fasta_o -M reads.fastq -o out_stampy.sam
[14:42:49] [map         ]    Mapping 61.00MB to 5.00MB with stampy...
[14:47:46] [map         ]    Took 296.478 (wall), 1150.536 (CPU) seconds, initialization time: 0.577 (wall), 0.244 (CPU) seconds.
[14:47:46] [map         ] Command(post): 
[14:47:46] [sort_prepare] Sorting...
[14:48:04] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:48:17] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
0,0,149993,0,7,149993,0,0,0,0,0