Tests Overview

Use the links in the list below to view results for an individual data set, or navigate this page to compare mapper performance across all data sets.

9 tests executed, 1 fail, 0 aborted, 0 errors total.
StateNameReferenceExecutedOKWarningsErrors
E_coliE_coli9805
Errors and Warnings
No problems were encountered.
Results: Correctly Mapped Reads
Results: Correct/s
Results: Precision
Results: Recall
Results: F-Measure
Raw Results
Setup

This section contains information about the benchmarking process itself and can be shared in order to reproduce results and diagnose problems.

Teaser Accessiona588fafacb71f50b55e5a5739e179558
Report timestampThu Aug 30 16:02:36 2018
Framework Version1.2-public-vevev
Framework Working Directory/project/teaser/genometeaser
Framework Command Line./teaser.py setups_generated/a588fafacb71f50b55e5a5739e179558.yaml -mcpu
Benchmark Configuration
evaluation: {pos_threshold: 50}
include: [base_teaser.yaml]
meta_timestamp: 1535633575.966971
report: {name: a588fafacb71f50b55e5a5739e179558}
sub_max_memory: 14000
sub_max_runtime: 900
teaser:
  tests:
    a588fafacb71f50b55e5a5739e179558: {coverage: 1.0, error_rate_mult: 1.0, mutation_indel_avg_len: 1.0,
      mutation_indel_frac: 0.3, mutation_rate: 0.001, paired: false, platform: !!python/unicode 'ion_torrent',
      read_length: 100, reference: !!python/unicode 'E_coli.fasta', title: !!python/unicode 'E_coli',
      type: !!python/unicode 'simulated_teaser'}
test_mappers: [bowtie2, bwa, bwamem, bwasw, cushaw3, ngm, ngm_0_4_11, segemehl, stampy]
test_parameters: []
threads: 4
Log
[14:52:57] [Main        ] framework cmd:  ./teaser.py setups_generated/a588fafacb71f50b55e5a5739e179558.yaml -mcpu
[14:52:57] [Main        ] framework hash: vevev
[14:52:57] [Main        ] deployment mode: devel (True)
[14:52:57] [Main        ] Test Runner Setup - ""

[14:52:57] [Main        ] Using Teaser for data set creation
[14:52:58] [Teaser      ] Init. Creating 1 test datasets.
[14:52:58] [Teaser      ] 
[14:52:58] [Teaser      ] Creating test a588fafacb71f50b55e5a5739e179558
[14:52:58] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558
[14:52:58] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558
[14:52:58] [Teaser      ] Loaded index from /project/teaser/genometeaser/references/E_coli.fasta.teaser.findex
[14:52:58] [Teaser      ] csample /project/teaser/genometeaser/references/E_coli.fasta 1000 0.500000
[14:52:58] [Teaser      ] Loaded index from /project/teaser/genometeaser/references/E_coli.fasta.teaser.findex
[14:52:58] [Teaser      ] Sampling as contig: 2566 regions of size 1000 (pad 200), totalling 2566034 base pairs
[14:52:58] [Teaser      ] Sampling 2566 regions
[14:52:58] [Teaser      ] 10%
[14:52:58] [Teaser      ] 20%
[14:52:59] [Teaser      ] 30%
[14:52:59] [Teaser      ] 40%
[14:52:59] [Teaser      ] 50%
[14:52:59] [Teaser      ] 60%
[14:53:00] [Teaser      ] 70%
[14:53:00] [Teaser      ] 80%
[14:53:00] [Teaser      ] 90%
[14:53:01] [Teaser      ] 100%
[14:53:01] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558
[14:53:01] [Teaser      ] subprogram /project/teaser/genometeaser/software/dwgsim -c 2 -1 100 -2 0 -N 150000 -f TACGTACGTCTGAGCATCGATCGATGTACAGC  -d 500 -s 50  -r 0.001000  -R 0.300000  -y 0  /project/teaser/genometeaser/references/E_coli.fasta.sampled.2.1000.200.fasta dwgout
[14:53:47] [Teaser      ] move enc_dwgout.bwa.read1.fastq -> reads.fastq
[14:53:47] [Teaser      ] move enc_dwgout.bwa.read1.fastq.sam -> mapping_comparison.sam
[14:53:48] [Teaser      ] remove dwgout.bwa.read1.fastq.sam
[14:53:48] [Teaser      ] remove dwgout.mutations.txt
[14:53:48] [Teaser      ] remove dwgout.mutations.vcf
[14:53:48] [Teaser      ] remove dwgout.bfast.fastq
[14:53:48] [Teaser      ] remove dwgout.bwa.read1.fastq
[14:53:48] [Teaser      ] remove dwgout.bwa.read2.fastq
[14:53:48] [Teaser      ] change directory /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558
[14:53:48] [Teaser      ] move mapping_comparison.sam -> mapping_comparison_unfixed.sam
[14:53:48] [Teaser      ] Translating SAM file coordinates (as contig)...
[14:53:48] [Teaser      ] Loaded index from /project/teaser/genometeaser/references/E_coli.fasta.teaser.findex
[14:54:06] [Teaser      ] remove /project/teaser/genometeaser/references/E_coli.fasta.sampled.2.1000.200.fasta
[14:54:06] [Teaser      ] remove /project/teaser/genometeaser/references/E_coli.fasta.sampled.2.1000.200.fasta.index
[14:54:07] [Teaser      ] remove mapping_comparison_unfixed.sam
[14:54:07] [Teaser      ] Took 68 seconds for generating a588fafacb71f50b55e5a5739e179558
[14:54:07] [Main        ] Data set creation completed
[14:54:07] [Main        ] 
[14:54:08] [bowtie2     ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[14:54:08] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:54:08] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[14:54:08] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_bowtie2.sam
[14:54:08] [map         ] Command(pre): 
[14:54:08] [map         ] Base run time file not existing, performing base run
[14:54:08] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bowtie2/bowtie2  -p 4 -x /project/teaser/genometeaser/references/E_coli.fasta_bt -U reads_base.fastq -S out_bowtie2.sam
[14:54:10] [map         ] Command(main): /project/teaser/genometeaser/software/bowtie2/bowtie2  -p 4 -x /project/teaser/genometeaser/references/E_coli.fasta_bt -U reads.fastq -S out_bowtie2.sam
[14:54:10] [map         ]    Mapping 40.00MB to 5.00MB with bowtie2...
[14:54:28] [map         ]    Took 17.379 (wall), 30.696 (CPU) seconds, initialization time: 0.378 (wall), 0.372 (CPU) seconds.
[14:54:28] [map         ] Command(post): 
[14:54:28] [sort_prepare] Sorting...
[14:54:55] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:55:04] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
131559,4869,13572,0,0,150000,0,0,0.964310845281,0.90648448643,0.934503958318

[14:55:04] [bwa         ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[14:55:04] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:55:04] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[14:55:04] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_bwa.sam
[14:55:04] [map         ] Command(pre): 
[14:55:04] [map         ] Base run time file not existing, performing base run
[14:55:04] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bwa aln /project/teaser/genometeaser/references/E_coli.fasta reads_base.fastq  -t 4 > out_bwa.sam.bwa; /project/teaser/genometeaser/software/bwa samse /project/teaser/genometeaser/references/E_coli.fasta out_bwa.sam.bwa reads_base.fastq > out_bwa.sam
[14:55:06] [map         ] Command(main): /project/teaser/genometeaser/software/bwa aln /project/teaser/genometeaser/references/E_coli.fasta reads.fastq  -t 4 > out_bwa.sam.bwa; /project/teaser/genometeaser/software/bwa samse /project/teaser/genometeaser/references/E_coli.fasta out_bwa.sam.bwa reads.fastq > out_bwa.sam
[14:55:06] [map         ]    Mapping 40.00MB to 5.00MB with bwa...
[14:55:29] [map         ]    Took 22.059 (wall), 43.396 (CPU) seconds, initialization time: 0.168 (wall), 0.048 (CPU) seconds.
[14:55:29] [map         ] Command(post): 
[14:55:30] [sort_prepare] Sorting...
[14:55:45] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:55:58] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
13197,484,136319,0,0,150000,0,0,0.964622469118,0.0882648010915,0.161730914171

[14:55:58] [bwamem      ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[14:55:58] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:55:58] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[14:55:58] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_bwamem.sam
[14:55:58] [map         ] Command(pre): 
[14:55:58] [map         ] Base run time file not existing, performing base run
[14:55:58] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bwa mem /project/teaser/genometeaser/references/E_coli.fasta reads_base.fastq  -t 4 > out_bwamem.sam
[14:56:00] [map         ] Command(main): /project/teaser/genometeaser/software/bwa mem /project/teaser/genometeaser/references/E_coli.fasta reads.fastq  -t 4 > out_bwamem.sam
[14:56:00] [map         ]    Mapping 40.00MB to 5.00MB with bwamem...
[14:56:25] [map         ]    Took 24.913 (wall), 33.676 (CPU) seconds, initialization time: 0.135 (wall), 0.028 (CPU) seconds.
[14:56:25] [map         ] Command(post): 
[14:56:25] [sort_prepare] Sorting...
[14:56:37] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:56:49] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
144093,5299,608,0,0,150000,0,0,0.964529559816,0.995798232217,0.979914516837

[14:56:49] [bwasw       ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[14:56:49] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:56:49] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[14:56:49] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_bwasw.sam
[14:56:49] [map         ] Command(pre): 
[14:56:49] [map         ] Base run time file not existing, performing base run
[14:56:49] [map         ] Command(pre-b): /project/teaser/genometeaser/software/bwa bwasw /project/teaser/genometeaser/references/E_coli.fasta reads_base.fastq  -t 4 > out_bwasw.sam
[14:56:51] [map         ] Command(main): /project/teaser/genometeaser/software/bwa bwasw /project/teaser/genometeaser/references/E_coli.fasta reads.fastq  -t 4 > out_bwasw.sam
[14:56:51] [map         ]    Mapping 40.00MB to 5.00MB with bwasw...
[14:57:29] [map         ]    Took 37.364 (wall), 87.372 (CPU) seconds, initialization time: 0.148 (wall), 0.040 (CPU) seconds.
[14:57:29] [map         ] Command(post): 
[14:57:29] [sort_prepare] Sorting...
[14:57:41] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:57:50] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
110459,4136,35401,4,42,150000,0,0,0.963907674855,0.757294666118,0.848200264921

[14:57:50] [cushaw3     ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[14:57:50] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:57:50] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[14:57:50] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_cushaw3.sam
[14:57:50] [map         ] Command(pre): 
[14:57:50] [map         ] Base run time file not existing, performing base run
[14:57:50] [map         ] Command(pre-b): /project/teaser/genometeaser/software/cushaw3/cushaw3 align -r /project/teaser/genometeaser/references/E_coli.fasta_cushaw3 -f reads_base.fastq -o out_cushaw3.sam -t 4 -multi 1
[14:57:53] [map         ] Command(main): /project/teaser/genometeaser/software/cushaw3/cushaw3 align -r /project/teaser/genometeaser/references/E_coli.fasta_cushaw3 -f reads.fastq -o out_cushaw3.sam -t 4 -multi 1
[14:57:53] [map         ]    Mapping 40.00MB to 5.00MB with cushaw3...
[14:58:37] [map         ]    Took 42.642 (wall), 82.488 (CPU) seconds, initialization time: 0.399 (wall), 0.036 (CPU) seconds.
[14:58:37] [map         ] Command(post): 
[14:58:37] [sort_prepare] Sorting...
[14:58:51] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:58:58] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
144497,5333,170,0,0,150000,0,0,0.964406327171,0.9988248875,0.98131390133

[14:58:58] [ngm         ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[14:58:58] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:58:58] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[14:58:58] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_ngm.sam
[14:58:58] [map         ] Command(pre): 
[14:58:58] [map         ] Base run time file not existing, performing base run
[14:58:58] [map         ] Command(pre-b): /project/teaser/genometeaser/software/ngm/ngm --output out_ngm.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress
[14:59:08] [map         ] Command(main): /project/teaser/genometeaser/software/ngm/ngm --output out_ngm.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads.fastq  --no-progress
[14:59:08] [map         ]    Mapping 40.00MB to 5.00MB with ngm...
[14:59:30] [map         ]    Took 19.993 (wall), 27.060 (CPU) seconds, initialization time: 4.501 (wall), 4.224 (CPU) seconds.
[14:59:30] [map         ] Command(post): 
[14:59:30] [sort_prepare] Sorting...
[14:59:46] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[14:59:53] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
144708,5286,6,0,0,150000,0,0,0.964758590344,0.999958538911,0.982043242803

[14:59:53] [ngm_0_4_11  ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[14:59:53] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[14:59:53] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[14:59:53] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_ngm_0_4_11.sam
[14:59:53] [map         ] Command(pre): 
[14:59:53] [map         ] Base run time file not existing, performing base run
[14:59:53] [map         ] Command(pre-b): /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress
[15:14:54] [map         ] Subprocess exceeded maximum allowed runtime: /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress at None:None
[15:14:54] [map         ] None

[15:29:55] [map         ] Subprocess exceeded maximum allowed runtime: /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads_base.fastq  --no-progress at None:None
[15:29:55] [map         ] None

[15:29:55] [map         ] Command(main): /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads.fastq  --no-progress
[15:29:55] [map         ]    Mapping 40.00MB to 5.00MB with ngm_0_4_11...
[15:44:56] [map         ] Subprocess exceeded maximum allowed runtime: /software/ngm/bin-linux/ngm-0.4.11 --output out_ngm_0_4_11.sam --ref /project/teaser/genometeaser/references/E_coli.fasta -t 4 --qry reads.fastq  --no-progress at None:None
[15:44:56] [map         ] None

[15:44:56] [map         ]    Took 0.000 (wall), 0.000 (CPU) seconds, initialization time: 0.000 (wall), 0.000 (CPU) seconds.
[15:44:56] [map         ] Command(post): 
[15:44:56] [sort_prepare] Sorting...
[15:45:07] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[15:45:22] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
141500,5173,6,3321,1755,150000,0,0,0.964731068431,0.999957598971,0.982028530878
[15:45:22] [calc_time   ] Runtime < Init runtime, using unadjusted runtime as mapping time at None:None
[15:45:22] [calc_time   ] None

[15:45:22] [calc_time   ] 	*** [INTERNAL] Error occured executing pipeline main on test a588fafacb71f50b55e5a5739e179558: 'memory', traceback: Traceback (most recent call last):
  File "/project/teaser/genometeaser/lib/test.py", line 432, in executePipeline
    result = script_locals[script_name](self, *args)
  File "tests_base/base_mapping/calc_time.py", line 42, in calc_time
    stats_out.memory = mapper_result["memory"]
KeyError: 'memory'

[15:45:22] [calc_time   ] Error occured executing pipeline main: 'memory', traceback: Traceback (most recent call last):
  File "/project/teaser/genometeaser/lib/test.py", line 432, in executePipeline
    result = script_locals[script_name](self, *args)
  File "tests_base/base_mapping/calc_time.py", line 42, in calc_time
    stats_out.memory = mapper_result["memory"]
KeyError: 'memory'
 at Test a588fafacb71f50b55e5a5739e179558:main
[15:45:22] [calc_time   ] Traceback (most recent call last):
  File "/project/teaser/genometeaser/lib/test.py", line 432, in executePipeline
    result = script_locals[script_name](self, *args)
  File "tests_base/base_mapping/calc_time.py", line 42, in calc_time
    stats_out.memory = mapper_result["memory"]
KeyError: 'memory'

[15:45:22]  -> Errors in test, not caching!

[15:45:22] [segemehl    ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[15:45:22] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[15:45:22] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[15:45:22] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_segemehl.sam
[15:45:22] [map         ] Command(pre): 
[15:45:22] [map         ] Base run time file not existing, performing base run
[15:45:22] [map         ] Command(pre-b): /project/teaser/genometeaser/software/segemehl.x  -r 1 -i /project/teaser/genometeaser/references/E_coli.fasta.idx -d /project/teaser/genometeaser/references/E_coli.fasta -q reads_base.fastq > out_segemehl.sam
[15:45:26] [map         ] Command(main): /project/teaser/genometeaser/software/segemehl.x  -r 1 -i /project/teaser/genometeaser/references/E_coli.fasta.idx -d /project/teaser/genometeaser/references/E_coli.fasta -q reads.fastq > out_segemehl.sam
[15:45:26] [map         ]    Mapping 40.00MB to 5.00MB with segemehl...
[15:53:43] [map         ]    Took 496.393 (wall), 468.344 (CPU) seconds, initialization time: 2.969 (wall), 0.368 (CPU) seconds.
[15:53:43] [map         ] Command(post): 
[15:53:43] [sort_prepare] Sorting...
[15:53:56] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[15:54:09] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
143860,5343,0,797,273,150000,0,0,0.964189728089,1.0,0.981768425219

[15:54:10] [stampy      ] a588fafacb71f50b55e5a5739e179558 (base: tests_base/base_mapping)
[15:54:10] [init        ] Ref:   /project/teaser/genometeaser/references/E_coli.fasta
[15:54:10] [init        ] Reads: /project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/reads.fastq
[15:54:10] [init        ] Output:/project/teaser/genometeaser/tests_generated/a588fafacb71f50b55e5a5739e179558/out_stampy.sam
[15:54:10] [map         ] Command(pre): 
[15:54:10] [map         ] Base run time file not existing, performing base run
[15:54:10] [map         ] Command(pre-b): /project/teaser/genometeaser/software/stampy  -t 4 -g /project/teaser/genometeaser/references/E_coli.fasta_o -h /project/teaser/genometeaser/references/E_coli.fasta_o -M reads_base.fastq -o out_stampy.sam
[15:54:14] [map         ] Command(main): /project/teaser/genometeaser/software/stampy  -t 4 -g /project/teaser/genometeaser/references/E_coli.fasta_o -h /project/teaser/genometeaser/references/E_coli.fasta_o -M reads.fastq -o out_stampy.sam
[15:54:14] [map         ]    Mapping 40.00MB to 5.00MB with stampy...
[16:02:05] [map         ]    Took 471.279 (wall), 1788.692 (CPU) seconds, initialization time: 1.174 (wall), 0.384 (CPU) seconds.
[16:02:05] [map         ] Command(post): 
[16:02:06] [sort_prepare] Sorting...
[16:02:21] [calc_stats  ] Compute mapping statistics (lib.evaluator.ThresholdBasedEvaluator, threshold 50)... 
[16:02:36] [calc_stats  ] correct,wrong,not_mapped,not_found,not_found_comparison,total,reverse,secondary,precision,recall,fmeasure
144621,5347,32,0,0,150000,0,0,0.964345727088,0.999778780945,0.981742645636