Results Overview

Mappers were evaluated for the given test data set. The table below shows the used parameters, mapping statistics and throughput for each mapper. Detailed results for a mapper can be displayed by clicking on its name in the table or the navigation on top.

StateMapperParametersCorrectly MappedWrongly MappedNot MappedThroughput (reads/s)
NGM92.253%7.746%0.001%6868
BWA0.000%0.000%100.000%56497
BWA-MEM89.802%9.833%0.366%5142
BWA-SW54.563%7.942%37.495%6184
Bowtie 253.484%4.725%41.792%15541

The figure below visualizes above results by directly comparing accuracy and throughput. The optimal mapper showing both highest accuracy and throughput, if any, will be located in the top right corner.

Data Set

For data sets that were simulated using Teaser, details regarding the simulation parameters are displayed here.

Input Data SourceSimuled data set (created using Teaser)
Sequencing Platformion_torrent
Read Length200
Read Count179658
Sequence Divergence0.0010 overall mutation rate, 0.3000 indel fraction, 1.0000 indel average length
Paired-EndNo
Insert SizeNone
Subsampling enabledYes
Simulator/project/teaser/software/dwgsim -c 2 -1 200 -2 0 -N 179658 -f TACGTACGTCTGAGCATCGATCGATGTACAGC -d 500 -r 0.001000 -R 0.300000 -y 0 -e 0.040000 /scratch/mate/refs/d_melanogaster.fasta.sampled.4.2000.400.fasta dwgout
Sampling ratio0.250
Sampling region length2000
Reference Genome File/scratch/mate/refs/d_melanogaster.fasta
Read File(s)/scratch/mate/tests_paper/D3_n/reads.fastq
Gold Standard Alignment File/scratch/mate/tests_paper/D3_n/mapping_comparison.sam
Mapping Statistics

This plot shows the fractions of correctly, wrongly and not mapped reads for each mapper and the selected mapping quality cutoff. Reads that have been filtered using the mapping quality cutoff are shown as unmapped. The interactive legend can be used to, for example, display only the number of wrongly and not mapped reads.

MAPQ threshold  
Mapping Quality

This section represents an overview of the distribution of mapping quality values for all mappers. A detailed evaluation of mapping qualities for specific mappers can be found on the respective mapper results page (accessible using the navigation on top). The first plot rates each mapping quality threshold (0-255) by comparing the numbers of wrongly and correctly mapped reads that would be removed due to falling under the threshold. The second plot shows the total number of reads for each mapping quality value.

 

Precision and Recall
Correctly Mapped/s
Memory Usage